90
|
ChemGenes corporation
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc07193604__41467_2020_15765_MOESM2_ESM-105-8-24?v=ChemGenes+corporation Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
barcode and linker sequences Barcode And Linker Sequences, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc04357952-67-4-18?v=GATC+Biotech Average 90 stars, based on 1 article reviews
barcode and linker sequences - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Fasteris Life
barcode and adapter sequences Barcode And Adapter Sequences, supplied by Fasteris Life, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc04856440__NIHMS780101___supplement___supplemental_information-334-2-15?v=Fasteris+Life Average 90 stars, based on 1 article reviews
barcode and adapter sequences - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Admera Health LLC
rna sequencing of barcoded mammary tumors, lung, and liver metastases was conducted Rna Sequencing Of Barcoded Mammary Tumors, Lung, And Liver Metastases Was Conducted, supplied by Admera Health LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06265294-427-5-13?v=Admera+Health+LLC Average 90 stars, based on 1 article reviews
rna sequencing of barcoded mammary tumors, lung, and liver metastases was conducted - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Nextera AS
16n molecular barcode unique identifier (uid) and a partial nextera b sequence 16n Molecular Barcode Unique Identifier (Uid) And A Partial Nextera B Sequence, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/us10280449-129-36-37?v=Nextera+AS Average 90 stars, based on 1 article reviews
16n molecular barcode unique identifier (uid) and a partial nextera b sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
minion cdna sequencing and barcoding Minion Cdna Sequencing And Barcoding, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm30514211-96-6-18?v=Oxford+Nanopore Average 90 stars, based on 1 article reviews
minion cdna sequencing and barcoding - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
native barcoding and ligation sequencing kits exp-nb104 Native Barcoding And Ligation Sequencing Kits Exp Nb104, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm39858336-144-9-15?v=Oxford+Nanopore Average 90 stars, based on 1 article reviews
native barcoding and ligation sequencing kits exp-nb104 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
BioSpyder Technologies
brb-seq or ‘bulk rna barcoding and sequencing Brb Seq Or ‘Bulk Rna Barcoding And Sequencing, supplied by BioSpyder Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06497160-33-10-14?v=BioSpyder+Technologies Average 90 stars, based on 1 article reviews
brb-seq or ‘bulk rna barcoding and sequencing - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Nextera AS
pcr-mediated barcode and sequencing adapter addition Pcr Mediated Barcode And Sequencing Adapter Addition, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm25188499-290-12-8?v=Nextera+AS Average 90 stars, based on 1 article reviews
pcr-mediated barcode and sequencing adapter addition - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
sequencing barcodes and adapters Sequencing Barcodes And Adapters, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc08372435-76-3-4?v=Oxford+Nanopore Average 90 stars, based on 1 article reviews
sequencing barcodes and adapters - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
barcode and tag-sequence for subsequent adaptor ligation Barcode And Tag Sequence For Subsequent Adaptor Ligation, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc11771736-82-2-25?v=Oxford+Nanopore Average 90 stars, based on 1 article reviews
barcode and tag-sequence for subsequent adaptor ligation - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
AGRF Ltd
barcode indexing and pair end sequencing Barcode Indexing And Pair End Sequencing, supplied by AGRF Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm39094661-57-20-16?v=AGRF+Ltd Average 90 stars, based on 1 article reviews
barcode indexing and pair end sequencing - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |