3′ sequencing and barcoding Search Results


90
ChemGenes corporation barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);
Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc07193604__41467_2020_15765_MOESM2_ESM-105-8-24?v=ChemGenes+corporation
Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GATC Biotech barcode and linker sequences
Barcode And Linker Sequences, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc04357952-67-4-18?v=GATC+Biotech
Average 90 stars, based on 1 article reviews
barcode and linker sequences - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Fasteris Life barcode and adapter sequences
Barcode And Adapter Sequences, supplied by Fasteris Life, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc04856440__NIHMS780101___supplement___supplemental_information-334-2-15?v=Fasteris+Life
Average 90 stars, based on 1 article reviews
barcode and adapter sequences - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Admera Health LLC rna sequencing of barcoded mammary tumors, lung, and liver metastases was conducted
Rna Sequencing Of Barcoded Mammary Tumors, Lung, And Liver Metastases Was Conducted, supplied by Admera Health LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06265294-427-5-13?v=Admera+Health+LLC
Average 90 stars, based on 1 article reviews
rna sequencing of barcoded mammary tumors, lung, and liver metastases was conducted - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Nextera AS 16n molecular barcode unique identifier (uid) and a partial nextera b sequence
16n Molecular Barcode Unique Identifier (Uid) And A Partial Nextera B Sequence, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/us10280449-129-36-37?v=Nextera+AS
Average 90 stars, based on 1 article reviews
16n molecular barcode unique identifier (uid) and a partial nextera b sequence - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Oxford Nanopore minion cdna sequencing and barcoding
Minion Cdna Sequencing And Barcoding, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm30514211-96-6-18?v=Oxford+Nanopore
Average 90 stars, based on 1 article reviews
minion cdna sequencing and barcoding - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Oxford Nanopore native barcoding and ligation sequencing kits exp-nb104
Native Barcoding And Ligation Sequencing Kits Exp Nb104, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm39858336-144-9-15?v=Oxford+Nanopore
Average 90 stars, based on 1 article reviews
native barcoding and ligation sequencing kits exp-nb104 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
BioSpyder Technologies brb-seq or ‘bulk rna barcoding and sequencing
Brb Seq Or ‘Bulk Rna Barcoding And Sequencing, supplied by BioSpyder Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06497160-33-10-14?v=BioSpyder+Technologies
Average 90 stars, based on 1 article reviews
brb-seq or ‘bulk rna barcoding and sequencing - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Nextera AS pcr-mediated barcode and sequencing adapter addition
Pcr Mediated Barcode And Sequencing Adapter Addition, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm25188499-290-12-8?v=Nextera+AS
Average 90 stars, based on 1 article reviews
pcr-mediated barcode and sequencing adapter addition - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Oxford Nanopore sequencing barcodes and adapters
Sequencing Barcodes And Adapters, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc08372435-76-3-4?v=Oxford+Nanopore
Average 90 stars, based on 1 article reviews
sequencing barcodes and adapters - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Oxford Nanopore barcode and tag-sequence for subsequent adaptor ligation
Barcode And Tag Sequence For Subsequent Adaptor Ligation, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc11771736-82-2-25?v=Oxford+Nanopore
Average 90 stars, based on 1 article reviews
barcode and tag-sequence for subsequent adaptor ligation - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
AGRF Ltd barcode indexing and pair end sequencing
Barcode Indexing And Pair End Sequencing, supplied by AGRF Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm39094661-57-20-16?v=AGRF+Ltd
Average 90 stars, based on 1 article reviews
barcode indexing and pair end sequencing - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results